SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00001793_2.0
Identity
PromoterGlutathione peroxidase (GPx)
SpeciesOchotona princeps (Pika)
Promoter IDSPR00001793
Promoter release2.0
External IDNone
Transcript SPT00001728_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00001793_2.0 # Promoter # Glutathione peroxidase (GPx) # Pika (Ochotona princeps) Full length # Forward
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCACTTCTCCCTTTTGTGCTGCTCAACAGAGCCCCAGGTCGCCCACTGGACACC
CCCCACACGCAGGAAGTGACTGGATAGGCAATTCCACAGCAACAGGAAGAGGCTCAGGGT
AACCGGCTCCCAGGACAGGACTTCCTTCTGCGGTGATGAAATGTTCTGGAACTCAATGTT
TTTTGTAACTTTTCCTCCAGGGTGAGCCCTGAGACTTCCTCTAATTCTCAAAGGACGGTG
TGTTTTTTTGTATTTTGGTTCTGGAAAATCTGTCCCTTGTGCCCCTGGGGGCCTTGCTCT
CCATACGCCTGAGCAATCCCAAATGCTGTGGCTGGGGTCACACCTGGCTTGGGGATTACT
TCTGGCGTGAGGAGGAAGGTCATCCCTGGCTTGGGGGTCACTCCTGGGTGTGAGGAGAGG
GTCACTCCTGGCTGGGGGGGGGGTCACTCCTGGCTGACCGTGTGTCCAGCTGGGGTCAGG
GCTGCGAGCGGCCAGTTCGCGGGGTGCGGGGCTCCCCGAGAAGGCAGACGCCCCGGGGAA
GTCCCGCTGTGGCCAGCGCGGGCCGCACCCTCCGAGGCCCGCGACCCGCGAGGCCCTGCG
GACACTGGACACCGCAAGGACACGGCAGCGCCGCGCGGCCTGAGGAAACGGTCCCTCCGA
GCCGTTTCGGCTTCGGCCCCGCGGGCGCGCGTGTCTCGTGGGGCCGTTGTGGAGCCCCAG
GCTCCACAGAAAAGCCGCACCCCCTGTGTCTTCTCGGGGCGCCTCGGCCACTTTGGTCCC
TCCCCAGTGTCCCGCTCACGGCCACTCGGCCCTGGCAGACTTGATCTGCCGTCACAGGAC
GCGGAAACAAGCGAGCATGCGCACTCACGGACCAAAACAACTTGCCCTTCTCTCCTCCTC
CTACCCCGCCTTCCTCCAGCCTCAGGCACAAGCCCGCCTCGCCCCTCACGCGCCGGCCTC
CCCATTGGCTGACGTGGCCAACGTCAGAGGAGCCGACGGGTTGGGCCAATGGGCGCGTGC
GTGGGCGTGGCCGAGGGTGGGGAGGCGAGGCGCACCGGCGCGCGTTCATTGGTCGGCTGT
GTGAGAGGGGAGGAGCCGTCGGCTCCCGGACCCGCCGCTGCCGCCGCGATGCTGCTGGGC
CGCCTGAGCCGCTTGCTGAAGCCGGCATTGCTGTGCGGGGCCTTGGCCGCTCCGGGGCTA
GCGGGCACCATGGTGAGCGGGCGGCGGCGGGCCGTTGGGGACCGGGGCTGGTGGGCGGAC
GCGCGAGGCCTGCTGCTCCCTGGCCGTGGTGGGATCCCCTCGGACCGGGGCGGCTGGAAG
GGGACAGTGTCCGGCTGAGACCCTGGGACACGTTTAGCTGTAGAAGGGTGACCGAGCTGG
GCCGCGCCTTTGCTCCTCCTCATCCTCCTGCCTGGGGTTCGAGGTCGGAGCCGGTGGGTC
GCCACGCCCGGACGCGGAGGCGGCTGGGGTTTACGCCTCAACCCTATTTACTCTCATTTT
TCCTGTGGGTCCCCCTAGGGACGGTGAGCATCTCAGCACCTAAGTGGGCGGCGGACCCCA
GGTCCTCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCTCCCGAAAAGCAAAAGGACCCCAGTGCAAACCCCGGGGCCCCGT
TCTTCCATGGTAGAACCCTAGGCCTCTAGAACCGGGCCGGCCGTTCCGCAGCCCGTGTGT
TTGCTCAACAAGTTACTGGAACAGCAGTGGAAAGAGGGTTCCTCTTTGTACCTCCACGGC
CTCGCTACATGTTTGGGGTGGGGGTCCCAAGCGCTCCTGCTGGGCACCTCGAGCCGGTGA
ATTTGCTCGCTTGCCCCAGGGGGCTCATTCAGGAAGGGGGGGTGGGCTCCCCCCCTTCGC
CGTGGTTCCTGGTCACCGAGTCCCCATCTTGCGTTGCAGTGTGCGTCCCGTGATGACTGG
CGCTGCGCGCGCTCCATGCATGAGTTCTCCGCCAAGGACATCGACGGGCGCATGGTGTGC
CTGGACAAGTACCGGTGGGTCCCAGGGAAGATGGCGACTGGGGAGAAGCAGGGGGTGAAA
GGAGGGTAGCCCCACTCCCC
Chart Advanced