SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000464_2.0
Identity
TranscriptSelenoprotein U1 (SelU1)
SpeciesCavia porcellus (Guinea Pig)
Transcript IDSPT00000464
Transcript release2.0
External IDNone
Gene SPG00000367_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward (Reverse in the original sequence)
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

ToolboxFull length   Spliced   5UTR   CDS   3UTR         Forward   Reverse
Sequence
>SPT00000464_2.0 # Transcript # Selenoprotein U1 (SelU1) # Guinea Pig (Cavia porcellus) # Full length # Forward
AGAATGTCTTTCCTCCAGGACCCAAGCTTTTTTGCTATGGGGGTGTGGTCCATTGGTGCC
GGAGCCCTGGGGGCTGCTGCCCTGGCGCTGCTCTTGGCCAACACAGACGTGTTTCTGTCC
AAATCCCAAGAAGCCACTCTGGAATATCTGGAGGACGTGGACCTGAAAACACTAGAGAAG
GGTAAGTAGTGACCCCGCTGTTCTCAGTACTTTTCCACTGCTCCAGGGTACTGGGTTACT
TACTCTTTTTAAACTAGCTCTTTATTTTTTGAAAAGGCAACATAACAGTATTAAGGAAAT
TATAATAACACTTTGTAAATTACATTGCTCCATTACTATAACATAATCATTGTTTTTATT
TTGGCCTATTCTTTTCCGTGTATACATATTATTATATGGTTGTGATCTTGGTATAAATTG
CTGTCTTATCTTTTTCTTTTCAACATCATTTTTCACTCTATTGTCTCTCTAACAGTAATT
GTAAATAACTTAGTAATACTAGATGATGTTGTAACGTCACTTAATAAGGTAGGCCTTCCC
CAGAGTGTTCCAATGAAATCCAGGCTTGTGGTATCTTCCTAAAAAAAGGAGCCCCTGAGT
TCAAGAAGTCTGAGACACACACTTGTTCATTTTCATGTTCCTGATGTTCAGTGTGAGGTC
TGGCACCCAGTGGATCTGGTTGCTACTGATGGGGTGCAGTCAGCCCCCTCTCCAGTCTGG
CACTGTAGTTCAGGCCTATCTGCCTCCCCTGGAGATCCACCCAGAATTCCCCAGAGGGTG
TAAAGCCACACACACACTCATGGTCGCCCTGCATCCTCACTGGCCATCTGAAGTATGCAG
GCTATAACTCAGTGGGCTTGGTCATATCCAGGTATACACTGGGGCTCGCAGGCTGAGGGT
ATCCAGGTTAGCACCCAGGAGGAAGCCACTGTGCTGCTCCCTGAGGGCACTTAGCTAACA
AGGGCAAAGGCATGATTGTATGGAAGGCTAGTAAGGTGCAAAGAAGCCTGTTGAGCTTTG
TTCAGCCCAGGCTTTTCAGTCTCCCTTCAGTTACAGTTTCTCTCTCTCCCTCCTTCCTTT
CTTGTTCACATAACATCCTATAGGACATGGATGCATCAGAGATAGAAATTAGGGTTCATA
TTTATTAAGCCCTCACAAACTGTTCGACCAGACTCTGATGAGTGTGTTTATATTCATCCT
TTGATGCTCCCTGCAACTCAGAGTGGGATTACCCCATACCTGCTTTTTACAAATGGACCT
AAGAGGAAAAGAGTGGCTTCCTTTTCCCAGGACCCAGCTAGAGTCAGGCTCCTAGCAACC
TCTGAAGCAGACTTGGGCTGCAATATTTCCTCACTGTACATCATCTGGCTGGCTTTATTA
GTAATAGTGTAATTAGCATGCTTAAGTTACATTACCTTTTTGTCCCTTGAATACATTCTT
AGGAACGGAGTAAGTTCAGAGTACAGAGCTTTGAGTCCAAGCCGTGTTTGTGTTGCATAG
GGTTGTTACAGTATCCCATGATGCCAGCATAAAAGGATTTATGACTGAGCTGGAAATACT
GCAGTTTGGAGGACTGAAGTTTGAAAGTAGATTTGGGGGGAGGGACCTTTTGAGCATGCA
GTCCACTCCTTAAGCCTTATCCCGCTCCTTGGGAAGATGCACAGTTTAGTCCTCTGCCAG
GCCTCATTTCTGACCTTGCTCAGGATTTGAGGCAGGGCTGGGAGGAGAGGATGTTGTTTT
CCATTTCTTCTCCCTTAGAACCAAGAACTTTCAAAGCAAAGGAGCTATGGGAGAAGAATG
GAGCTGTGATTATGGCTGTGCGGAGGCCAGGCTGTTTCCTCTGCCGTGAGGTAAGTGCTT
TTGAGAATCTGTTCAGAGCAGAGGATTCCAACAGATGGGGCTTTCAGTTTCCATGCTGCA
GGCCCTCCTTGCCCTTCATTCAGCTACAGGCTGTTCTCTTTTATTTGCACCAGTTATTTC
TTAGCATAGGCTCTGTTCCTGTTCTGTAACCCTTGCCACCTCTGACTGGGGCTGGCAACA
CATCTGAGTTCCCTGGTGCTTCCAAGCCTTTCACCTTGTGTTGTTTCAGTGTCTGTCCCA
GACTACTTCCACCTGCCCCAGGGTATCAGTGAGGTCCAATGCCATGGTCCTGGCATCAGC
ATGAAACTCACCTATGAAATGGGGACTGGGCTGCTACTGATAGGGTGTGGGTAACCCCCA
ATTGTAATGGGGCTGCAGCATGAGCAGATGCTGTTTAAGGCCACACTTTAGAACAGATCT
GCCTGTCCGTGGCCTGGGAAGCCACCAAGTCCCACCTGGGTATCTGAGTACTCCACACTC
CATCGTGACTGCCCTTCTGACTCACTGCCCCTCTCACAGGGTTGGGGTGCCCATCATGCT
GATGGCATGGTGCACTGGCAGGAGAGCCAGGAGAGCATTGTTGCTCACTAAGGAGTCTCC
TGGTTGGCCCATCGCTACCTGTGCAGGAAGTGAGGAAACCTATGAAAAGAAGGCACCTTG
TGTCAGAGGGGACTTGTCACTTTGTGATAAGCAAGCTGAGGGCCATTGTGGTTTGGTAGA
CTGCCCACTCAGGAGCTGAAGTGTCAAGTTCTCAGATGGCTGCCTCGTGTGGAAGAAAGC
TGAGAAAGGCAGAGCTCCTGTCCCGGCAGCAGCCTAGCTTCCCAGACCCTAGCTTCAGCC
TCGCCCAGGTTCCTATCCAGATTCCACAGGTCATCTCCCACTCCAAAGGGTCCCCTCTGT
AGCCTGGCTGTCTCTCCTGTTCATGTGTGAGAAATCCGCCTACTCACATAGCACATCTAC
ACCTGTTTCCTTGGTTGTCCCTCACCATATCTCCCGGAAATTTGACTTCTCATTACATTT
CCCTTTTCACAGAGGCAGCAGTGGTGTGGAGGTTGGAAGACAGCTGCACTGCCAAAGAGG
TGTATCAGCTTCCTGTTGCTGCTGTAGCCACATCAGAGTGGCCACTAGCGCAGGGCCCTT
AAACAACACAGTTATTGTCCAACCCTGGGTAGCATGCAATTACATTCCTCCTGGAGGCTG
TGGTGGAGGATGCATTGCGTTGCCTTCTCCAGTCTCTGCAGGCTGCCAGAATTCCTTAGC
TTATGGCCTGTTGCTCTGTTTTCTAACTCAGTGATGGTTGGTCAAGTCATCCCCATGTTA
TAATCCTATGATACTAACTTGTCCGCCTCCCTCCTTCACATTTTAAGAGTCCTGGTGATT
ACATTGGGCCTGGCAAGATAACCAGGAGAATCTGTGTGTCTGGCTGGCTGGCTGGCTGGT
TGGCTGTGTGTGTGTCTGCGCATACAAGTGCTGGATTTGAACTCAAGGTATTGGGTCTGT
TAAGCACTCTGTACTCCTAAACCAATGCCCCGACCCACAGGACAATCTTTTTACTAATCA
GCAGCCTAAATTTCATCTCAGGCTTCATTCCCCCTTGTTATGCCACAGAATATGTTCATG
CTTCCAGGGAATTAGGCTGTAGGTATGTTTGGAGGCTCACTACTCTGCCCACCACTACAG
CAGAGTTTAAACTTGGGGCTTTTCATTGCAGGTCTGTAGTGCCTGGAGACACCAATATGG
AAACCTGTTTGACTTGATCTCTTGAGACAGTGAAACTCAGGGGGTTCCAAAAACAACACT
TACTGCTAATTGCATCCTGTTTTCCTCTGTGCTGGTCCTTGCTGTGGTACATCATTGTAT
AAAAACAGTTTTCAGGATGGTGGCTGGGTGGCAAGGTGGTAGTCTGAGTTCCTGGGAGAA
GCCCAAGGAGAAGGTGCATGACTCAATTTCCACTTCATGGCTTTTCACAGGGAAATACCC
AGGATGAAGAGCACAGAAAAAGCAAGGGAAACTTAATCTTCCACAGATGGTCTTTGACCA
TATCAAACACTGCTGTCACTGCTCTAGGGAAAAACTGCCAGGCCCTAAAACTCTTGATAA
ATGCATTATAATTAATTCTCCTGTGCCTGTTATCCTATCTTCCCTATTTTAGAAAGTAAT
GAAAACTTAATTCTAGTTGCCAGTATAGAGCAGCATGTTTGTTGTTGGAGATGAGCAGGC
TCCTTTTTAAAGGATTTCCTGCTGATTCTTTTAATTCTGACACCTAATGTGAAAAAGAAA
TTTGTTAGGCTGAAGCCTCTCTGTCACTCCTGTGATTGTTATTCATCCGCACACAGTTCC
CAGGGACGTCCATACCATACTGCTCAACTGCACTGTATGCATTGTTCAGCTTCAGATCAT
TCTGCCTGATATCTGTACCCTCTCTGTATCCAGCCTTGTGCCAGGCACCGAAGCTCTAAG
AAATGGAACACTTAGTTTCTGACTGTGGGGGCACATTAGGGATTCAGCAACAACATTCAG
CTTAACAGTGACATCTGGACCTAGCAAAAAACCACCAAGCAGGGAAGATAGACACACAGA
CAGAGCTTCCCTGTACAAACATCTTTCTAGACCAGAGAGGCCTCCCCGAGAGTCAGGTTT
GAGCTGGAAAGAGATGGAGGATTGCAGCAGATGTGAGGGGCCCCAGTACAGCAGTGTGGG
GTTTGGTCATGTGGTCTGTGTGGTATCTGTCTGTGGGTCCATTGCCAGTTCAGCCTAGCA
CAGTGCTGGGGGCGAAGGACCTGTTGGGATGCAGCCTCCCAGTCGCAGCTGCTCCCAGGC
TGTTGTTGGGACTCAGAACAGGAGCCAGCTCTACTTTCCACCCCAGGAAAGACAGGAAAC
CTGCACGGAGGAGGGTGCCTGACACAGACTGGCAGCTGGAGCCCGCTGGGACAGGTGCAG
CCTTGGCTCCGCGGTCTGAACCATCTAGCCTTTTGTTGCTGCTGTTCCTCTCCCCACAGC
ACCAGCCATCCTCTGGCCAATCAGGGTGAGAATACATTGTTGACCCCAGAGCCCCGGGAC
TTCATGGCCCTGAACTTGAACCCCTCTTGTCCTGCAGGAGGCTGCAGACCTGTCCTCCCT
GAAACCCCAGCTGGATGCATTGGGTGTCCCCCTCTATGCCGTGGTGAAGGAGCAGGTCGG
AACTGAAGTGGAGGACTTCCAGCCTTATTTCAAGGGAGAAATCTTCCTGGATGCTCAGGT
GCATATGCTGTGATTGGTGAGGGCTGTCTCAGCTGTGGAGAGTTGGGGGGCTCAGGTCAT
GTCTTGCTGGAGATGTGTGCTGGTCGTCCCGTTGCTGCCTTGCAGGGGCTTCCCAACCAT
CAACACAGGCTGTCCTCTTAATTATCTCTGAATTCTCTCCCTGCAGCATGCCCCAGGAGG
GTGGGAAGTAGATAAAACTCTGTCAGGTGCCCAACATGCAGGTGGGAATCCTTGGAAGAG
ACTGGAGGAATGCAGAAGCTCTCTCCCCAGACAAAGGGCTGGGGCCCGCTTATATTAACT
CTCAATGGGTGGTGCAAAACTGGCTGGTGACAGTGGAACAGGAGTGATGTTTTTATCTAG
GAATTGGAATGCCTTTGTCGAGAGTGGGAAGGAAAGGCAGGGAGTCTGTTTGGGGTCTGG
AGCACTGTAGGAAGAAGATTGATAAAATGTCATTTTATGGTCTTGTGGCCACGTTGGACC
TCCACCACGGTGAGGGGCAAATTAATGTGACTAAACACCTATCAGTAAGAAATAAGAGGC
AGGAACTGTAGCTCAGTGTGAGGGTGCTTGCCTAGTGTGTATGATGCTCTGAAGTGCTGC
ACAATAATCATAACAGTAATGCCAGTAATCCCACAGGCATGGTTATAAACACTTACAATC
CCAGCTGCTTAGGAGACTGAGATGAGATCATAGGTTCAAGACCAGCCTCGGCAAGATAAT
GAGACCTTATCTCAAAAAATAAAAAGGGATCTGAACGTGTATCAGTGCTCCCTGGGTGCC
ATCAAGAACCACAGAACACAAAACAGTGAGAAGACAGAGTTGCTTCCCTCAGTCAGGCCT
GCCTCAGGTCAGAAGTGGAACTCATGGCTGGGGATGTAGCTCAGTGGTGGAGCACTTGCC
TGGCATATGTGAGGCAAGCGCATGCACATGCACACACATATGCACAGTTTCTGAAGAAGA
AGCTGCATCTGGCAGGAGTTTCTGTCTGCAGGCAATTGAGAGTGGTCCTGGCAGGGTGAG
CAAACGACTTGACCCAGCAGGATGGGGGCTTTGCCTGCTCTCAGATGTCCTGCCTGGAAC
CTGGCCCTCTGGGCAAGGAAGCATACAGGCTGCCCATGGGGCTTCTTTCTTGCTTTTCAG
AAAAAGTTCTACGGTCCACAGAGACGGAAGCTGCTGTTCATGGGATTCATGCGTCTGGGC
GTGTGGTGCAACTTCTTCCGGGCCTGGAATGGAGGCTTCTCTGGAAATCTGAAGGGCGAA
GGGGTCATCCTTGGGGGAGTTTTTGTGGTGGGATCAGGAAAACAGGTAAATTCTCAGTGT
TCTTCTTGTGGGTCAGTGGGGGTGTCGAGGGCTGACTTTCCCTGCTCAGGGCCTCCTGGC
CTTCCTTTTAGGACCAGGAAGCATGAAGAGGGGAAGGGAAGGCAGATGTCATACTATAGT
CAGAAGCAGCGTGACCACATTGCAAATACAGGTCTTGGGACCTGGAGAGCTGAGTGACAG
CACTGAGGAGCACAGCTCCACGGTGGCACTTAAGGCTTGGACCTAGGCCTTCTGACTTTA
GGTTCTGTCTTCTGGGCGTGAACCAAAGCGTCATTTGTACTCTCTTTATGAGTTATTCTT
TTAGTGCTTTTCCAAGCCATGATGGAGAAAGCCAAGAGGAAAGAAGGAAAAAAACAGGCC
TGATGGGGCAAGTAGCAAGGGGGATACACACTTTCCCCTGTGAGGGGCTTGGTGCTGGGG
TGGAGCCTGGAGAGGTGCAGAGAGACCATGGTGAGGCTGGGTCCTAAAGACCCAGAGTCA
ACCTGGGGACATGGGAGGAAGAGATGGAGGAGAACATTGAGGTCATGGTGGGCCCCTGAG
CAGGGGCGTGTGTCCCCTGTAGATGGTGTGGGGCAGTGCCATCCATGCATGAAGATGAAC
AGCAGGGGCAGGGCAGAGCGAGGGCAGGTAGGGCAGGGGGACAGCCTGCGACTGGCGGCC
TAACTTCAGGCCAGTCTGTCAACCTTGCTTGTGACACAGCTCAGAAAGAAAAGAAAGTTT
TTCTCTATGTGGCAGGACAAAATGATCTGCAGCATTGGATCTCACCACCAATGTTGATAA
TTGCTCTTTTCCCAATTTAAAAGATCTGAAACTGAGAATAGAAGCCATTGGATAAGCTTA
TTTCTGATCTCTTTCTTTTCTATTTTGCTTTGATAACTGTATTTGCTTCTGTTAGAATTT
GCAGTTGAACAGTGTGTAATTTAATGAAACCTGTTTGCTCATTTGATGGTAAACAGATAA
AAATATCAGTGGTAGTGACTGTGGGAGCATGACTGCCTGTCTGCCCAGGAGCCCACACAG
GAAGTTGGGTCCTCCGCGGCCAGTCTGGGATGTCAAGAACTCTTGTCCCCATCTACCTAG
AAGGCAGTGAGCCTAGAGATAGGAAACCAGTCATACAGACACAGCAAGGAGGAGTATGAT
GGAAATGAAACTTGAAGTGAAATGCAAATTTCACTGCCCCTTCCCTCTGGCTCTGCCTCC
CCTGGCCTCTGCAGCAGGGTTTGGTACACCTGCCAGTCTCTTCTTGCTTCAGAGTGACTC
ACCTGGTGCTCACAGCCCAGTGGCACATTCCTGCGTTGCCAGGTGTGATGTTTGAGTTTG
TTGGTGTCCCTTGAGCTCCTGGCTTTCCTCAGCCCCAGGGAAGGCTTACGAGGCTGGCTG
AGCACCAGGACTTACCTGCCAGGTGCTGCCCGTGGGGATACTGGGTATCCATCATTGTTC
ATGTTCATGCTTTTGTTTTTGTTTTTGATGATAATAATCTATAAGGCATACTTAAAGAAG
TAGAGAGAAATGTACTGCAGAAAATTTGAAAATAGCAATGTGATGGTGAGGTCATCCTGC
AAGTTCAGCCACCGTGGGCAGCCCACTGGGACAGAGCTGAGTGGCTTTAGCTTTGTCTCA
TTTTCAGAAGATAAAGTATTATCGAAGCAAAATTTTTTCCTATTAGTAATGTGTCTTGCA
CGTTTCTCCATGTCGTTATATATTCTTCCTCAGTATGCTGCTGTTATGCTTTATTGAGCA
AGCAAATATGATTTCCTGATCTGCCTGTAGTCACCATCACAGGTTATTTTTTTAAGTCTT
TATAGATAATGACAATGTATTTACAGTTTTTTAAAATTAAATATAAGATGAGTTTTCAAA
TGTTATGGGTTGGGCCGGGGATTTAGCTCAGCGGCATAAGTGCCTGCCTTGCAAGTGTGC
AGCCCTGAGTTCAATCCCCGCTACCGATTAATTAAAAAACAAAAAGTCAAATGTTATGAG
TTAGAGATATTTTTATCAAGCACTTCTTAGCACTCATCTCAAGCTATTATATCATATCAT
ATCATCATATCATCTTATATGGTGTGGTAGTTTAGGGTAACTTTGGGGTATCCTGTACCT
CAGTGTGTTTTCCTTCACGATAAAAAGAATGGCTCACAGTTTCTCAGGAAGACTGAAGAA
AGGCATTGGCTTTCCTTCTCAGCTGGTCATTCAACACCTGCCAGAGTCTCACCTCTCGAG
TTCTGCTTCTTTGAGTCTTCCTGTGTTAACTTCATTCTGTGGTCTTCAGCTGCAGCATCC
CTTTACCTCTCTCACTTCCTGTGTCCATCCTGCTGCCTCCTCCTGTGCTTCCTGGTCTGT
GAAGCCTTCCCTAACCCCTTTGTCTGGCTTCAGCTGCGTGTGCAGTTCAAGTGCTGTGAA
GTGGCTTCCCTAGGAGAAAGGACCCAGGGCAGGTGCCCGGCCTGGTGCAGCTCTGTGTCC
TCTCCTCAGGCATAGGGCTGTACAGACAGCTGGCACTCAGTGGCTCTCTTATGAATGAGG
ACTGATGTTCCCTTCCATTTCTTTTCAGGGTATTCTTCTTGAGCACCGAGAAAAAGAATT
TGGAGACAAAGTAAACCCACTTTCTGTTCTGGAAGCTGCCAAGAAGGTCAAACCCAGGAG
TTTAGCCTCAGAGAACCAGTGA
Chart Advanced